Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br GSH NADH and NADPH Measurements

    2020-08-07


    GSH, NADH and NADPH Measurements
    Free Heme Measurements
    Free heme was extracted with neutral acetone as described (Espinas et al., 2012). Heme from neutral acetone extracts was quantified with the Heme assay kit (MAK316-1KT, Sigma-Aldrich), and measurements were normalized to protein concentration. To induce release of free heme by ROS, Resiniferatoxin were treated with 200 mM hydrogen peroxide overnight.
    For labile heme measurements with a heme biosensor, A549 cells were treated for 18 days with NAC, Trolox, or vehicle (water and DMSO, respectively) and transfected with the genetically encoded heme sensor pCDNA-HS1 (Hanna et al., 2016). Briefly, 5.6 3 104 cells per well of a 96-well plate were reverse transfected with X-tremeGENE HP DNA Transfection Reagent (6366244001, Sigma-Aldrich) at a 1:3 DNA:Transfection Reagent ratio and seeded together with medium supplemented with antiox-idant, vehicle, or pro-oxidant (diamide, 5 mM, D3648-1G, Sigma-Aldrich). Cells were incubated at 37 C for 48 hr before eGFP and mKATE2 imaging (HCS Operetta, Perkin-Elmer). The values presented correspond to 3 transfections per treatment. Each data point is the average of the fluorescence intensity ratio of eGFP to mKATE2 of 23 fields of view.
    Lentiviral Production and Transduction
    Lentiviruses were produced by transfecting 293FT packaging cells (R70007, Life Technologies) with lentiviral backbone constructs (6 mg), packaging plasmid psPAX2 (Addgene plasmid #12260, 3 mg), and envelope plasmid pMD2.G (Addgene plasmid #12259,
    For sgRNA cloning, the lentiCRISPRv2 vector was digested with BsmBI and ligated with BsmBI-compatible pre-annealed oligo-nucleotides. The following sequences were used for CRISPR-knockout strategies: sgdTomato GGCCACGAGTTCGAGATCGA; mouse sgBach1_m1 GTACTTCCACTCGAGAA-TCGT; sgBach1_m2 GTCTGGCCTACGATTCTCGAG; human sgBACH1_h1 CCTG GCCTACGATTCTTGAG, sgBACH1_h2 CCACTCAAGAATCGTAGGCC; and sgBACH1_h3 TACTCAGCCTTAAT-GACCAG. For the transcriptional activation strategy with dCAS9-SAM, the following sequences were used: sgdTomtato, GGCCACGAGTTCGAGA TCGA; mouse sgBach1_m2, GGCCCGGGGGCGGAAC-CGG; and human sgBACH1_h2, GACACATCAGCACCGCCCTCG. Expres-sion of target proteins in CRISPR-knockout and CRISPR-SAM experiments was evaluated by western blotting 3–5 days after selection. The pSECC lentiviral vector and cloning strategy are described elsewhere (Sa´nchez-Rivera et al., 2014)
    Western Blotting
    Cells were lysed in buffer containing 9 M urea and Halt protease inhibitor cocktail (78430, Life Technologies) and Halt phosphatase inhibitor (78428, Life Technologies). Alternatively, cells were lysed in Laemmli buffer supplemented with b-mercaptoethanol. Cyto-solic and nuclear extracts were prepared with NE-PER nuclear and cytoplasmic extraction reagents (78835, Life Technologies). Protein concentration of lysates was determined with the Pierce BCA Protein Assay Kit (23225, Life Technologies). After denaturation, equal amounts of proteins were resolved on 4%–20% or 12% Mini-PROTEAN TGX Stain-Free gels (BioRad), and electro-transferred onto nitrocellulose membranes. The membranes were blocked with TBST containing 5% milk and incubated with antibodies against BACH1 (sc-271211, Santa Cruz Biotechnology, 1:1000), HO-1 (MA1-112, Life Technologies, 1:1000), HK2 (PA5-29326, Life Technologies, 1:2000), b-actin (A228, Sigma-Aldrich), GAPDH (G9295, Sigma-Aldrich, 1:1000), histone 3 (ab1791, Abcam, 1:5000), NQO1 (HPA007308, Sigma-Aldrich, 1:200), KEAP1 (#8047S, Cell Signaling, 1:1000), and NRF2 (#12721, Cell Signaling, 1:300). Secondary antibodies were from Jackson Immunoresearch laboratories. Clarity Western ECL sub-strate (1705061, Bio-Rad) was used for detection with the ChemiDoc Touch Imaging system (1708370, Bio-Rad).
    Cell Viability Assay
    Cell viability was estimated with Presto Blue Cell Viability Reagent (A13262, Life Technologies). Cells (5000/well) were seeded in 96-well plates in triplicate. After 24–72 hr, PrestoBlue reagent (10 ml) was added to wells with cells or medium (blank), and absorption at 570 and 600 nm was measured with a Synergy plate reader (BioTek). To assess the effect of KI-696 on cell viability, 2.2 3 104 cells per well of a 24-well plate were treated with KI-696 (5 mM) or vehicle (DMSO). Cells were incubated at 37 C for 48 hr before assay of cell viability (Vi-Cell XR, Beckman-Coulter).
    Extracellular Flux Measurements
    Metabolic analyses were done with the Seahorse XFe96 Analyzer (Agilent), which measures the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) of live cells. Glycolytic rates were measured with the Seahorse XF glycolytic rate assay (S7805A, Seahorse Agilent), ATP production rates were measured with the Seahorse XF ATP rate (103592-100, Seahorse Agilent): cells were seeded in Seahorse XF96 microplates (15,000 cells/well) (101085-004, Agilent) and cultured overnight at 37 C in a CO2 incubator. On the day of the assay, the medium was replaced with freshly prepared phenol red–free base medium supplemented with HEPES, glucose, pyruvate, and glutamine and adjusted to pH 7.4. Cells were incubated for 45 min at 37 C in a non-CO2 incubator before the assay, and the medium was changed immediately before the assay. Before assays, the Seahorse Analyzer pre-warmed to 37 C. Data were normalized to cell numbers obtained from additional wells using Presto Blue Cell Viability. Glycolytic and ATP production rates were calculated with the Macro Excel file provided by the manufacturer.